Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone DB0013
Clone ID DB0013
Vector pGT1lxr
Project sanger

Sequence tag DB0013
Sequence
GGAGTGTCGCGCGTCGGCGCCGCTGCTTATCCCGCTCTGTGCCCTACGGCCCTCCCGGCACCCGCCGCCGTCCTGCTCCG
GGCTGCCCTTGCTCCGAGGGCTGCAGCTCCGGCCGTCCCCGTCAGCCCTCTTGTCTGGCCGTCGGGTCGCGGTGGGCGGG
AGCAGCCGGAGGAGGAGCCGCAGCCGGGAGGCGGCGGCCTGAGCCCATGGCGTACAGTCAAGGAGGCGGCAAGAAGAAAG
TGTGCTACTACTATGATG
Sequence Type mRNA
Unitrap ID UNI487

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 36694353..36694609 245
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019777 (Hdac2) NM_008229 histone deacetylase 2 Gene [Source:MGI (curated);Acc:Hdac2-001]

 
Come back to gene ENSMUSG00000019777


For any suggestions or comments, please send an email to unitrap@crg.es