Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST246561
Clone ID OST246561
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST246561
Sequence
GACTGAGCGCCTTCCCAGCTGTCACTGAACTGCATTATTCATCGCTGTCTTTGGGCTGAAAAAGAAACCCTTCTGATCAC
AATCCAGGTGTAGGGACCAAGGCTGGAAAAGTGATGAAGCTTCCTCCCACTGCTGCAAGAAAAAGGCAGAGGCTTCAGTT
TTCTCTCGCCCAAGTCCCTTGCCTCCTCCCAACTGCGGCTAAGCAGAGGATGGCAGTGTTGGAATAAGATCTCTCAAATC
TTGGATTATAATTTTATTAGAGTTTTGTAATAAAATTTATTTTATAACAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI23732

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 68886246..68886530 276
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020895 (Tmem107) NM_025838 transmembrane protein 107 Gene [Source:MGI (curated);Acc:Tmem107-002]

 
Come back to gene ENSMUSG00000020895


For any suggestions or comments, please send an email to unitrap@crg.es