Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTA370
Clone ID YTA370
Vector pGT0Lxf
Project baygenomics

Sequence tag YTA370
Sequence
GATGAAGGGGAAGAGGAGAAAGATGATCTGGCAGTGAGTAGCATTAGAAAGTAGGCACCAGTCTCCCTCTTGGACACCGA
CAAAAGGTATTCTGGCAAGACCACTTCTAGGAAAGCTTGGAAAGAAGACCATTGGGAGCAGGCTCTGCCAAGTTCATCTG
ATAACGAAGCATCTGATGAGGGAGGATCTGAAGATGGGGATTCAGAGGGCCTGGGCCTGGAGGAGATCTCAGAAGATGTT
GACGAAGACTTAGAAGACAACAAAATATCTGATGAGGGAGGATCTGAAGATGGGGATTCAGAGGGCCTGGGCCTGGAAGA
GTTCTCAGAAGATGTTGAGGAGGACTTAGAAGGTGAGGATGAGGAAGACAGAGAAGAAGACAGGAACAGTGAAGATGATG
GTGTGGTGGCAGCCTTCTCCAGTGTCAAAGTTTCTGAGGAAGTGGAAAAAGGAAGAGCTGTGAAGAATCAGATAGCATTG
TGGGACCAGCTCTTGGAAGGAAGGAT
Sequence Type mRNA
Unitrap ID UNI138

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 84323268..84325802 222
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018697 (Aatf) NM_019816 apoptosis antagonizing transcription factor Gene [Source:MGI (curated);Acc:Aatf-001]

 
Come back to gene ENSMUSG00000018697


For any suggestions or comments, please send an email to unitrap@crg.es