Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST246332
Clone ID OST246332
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST246332
Sequence
ACTGAGGAGTGCCAGCACAGGAGGTAGGCACCAGCCAAGCTNATGGNATACCTACAGCGCTTNANGCCTCTGGACTATCA
GCGCCTGCTAGANGCAGCCAGTTCTGGTGAGGCCACAGGGGACTCAGCATCCTGACAACAGCGTTCACTTTCCAAAAGGG
AAGGTAACTCTGAAGCCGCCATTCACATCCGGACCCACGGTGCTCCTTTCCCTTACAACGGAGCCACTTTCCCCTCCAGC
TCTGNCTGGTCTTTCGCCCACTCTGAGCTATCCTTCCTGGAGCCCTCCCTGGCTGCTTCCCTCATCCGTCAGATGCAATC
TGTGGGCCGCCCCTCTCCCCTGGCCGCTAAGCAGCCTCCATTGATTTCCGCTCGTGTTTATAGGATTTCCACTTAGCCGT
GATCAGTAGTTAAGCACAGGAAAATCCCTTGCCACCCCCCCCTCCCTTGGTCGATGCCATTGATTCTGCCAGAGGCTCTG
AAGCCGCCTTACAGCTGAGTTAGAGATGAGGGGAAACAGCGGGGATTTCCCTGCCCTGGGGTGTAGGGAAGAGCAAGAAG
GTGGGGAAAAGGTTAGG
Sequence Type mRNA
Unitrap ID UNI17735

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55716215..55716786 557
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045691 (Thtpa) NM_153083 thiamine triphosphatase Gene [Source:MGI Symbol;Acc:MGI:2446078]

 
Come back to gene ENSMUSG00000045691


For any suggestions or comments, please send an email to unitrap@crg.es