Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST246318
Clone ID OST246318
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST246318
Sequence
ACTGAGGAGGTATTTGATCATGGGTCACCTGNGAAAGCNANGGCANATCCACTAACCNGANNCTACNTATGAGGAANAAC
TGNAANCTGNNCTGGCTNCTTGATTNGAGTATTTATTAANGCAGACAGAGCCTGTTCGCACATTTCATTCAGCCTGCTGC
TCAGAAGACTCCAACCTCACCCTTGAAGATGAAACCAGGGCCGCCCACGGGTAAAAAAGGATAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI23740

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 83257612..83260664 113
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031715 (Smarca5) NM_053124 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 Gene [Source:MGI (curated);Acc:Smarca5-001]

 
Come back to gene ENSMUSG00000031715


For any suggestions or comments, please send an email to unitrap@crg.es