Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST246207
Clone ID OST246207
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST246207
Sequence
ACTGAGATAATGCTAAAGACTGCAGCTAGTGGTTTTGTTCTTGTCCGAAGAAGCAATCCTTCGATCTGCACCTTGACCTC
ATGTTCCCTTGACATCACAGCCTCATGTCCGACTGCTGGTGCTTCATCTTCTGCAAGGAACACGTTAGAAGCAATCCTCT
GTCACCACAGCATGATGGGGCCTCAAGGGAGGAGGCTGATCACCAGGTGGACGTGTCTGATGGCATCAGGCTGGTTCCAG
ACAAAGCAGAGGCCACGGCTGCTACAGCCTCAGAA
Sequence Type mRNA
Unitrap ID UNI17535

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 12879886..12880150 265
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031442 (Mcf2l) NM_178076 mcf.2 transforming sequence-like Gene [Source:MGI (curated);Acc:Mcf2l-009]

 
Come back to gene ENSMUSG00000031442


For any suggestions or comments, please send an email to unitrap@crg.es