Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSI796
Clone ID CSI796
Vector pGT0Lxf
Project baygenomics

Sequence tag CSI796
Sequence
GGTTGTGAGCTTTTTTAGATGGTTTTTTTTTTCGCTAGGTTTCTTTTCTGTTTTTGCGTACTTTTGGTTATCAGTGGAAG
ATGTCTGGTCGTGGCAAGCAGGGCGGCAAAGCTCGTGCAAAAGCGAAGTCTCGTTCTTCCCGTGCCGGCCTGCAGTTTCC
AGTGGGCCGTGTGCACCGCCTTCTCCGTAAGGGTC
Sequence Type mRNA
Unitrap ID UNI5624

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 58768188..58768353 166
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036964 (Trim17) NM_031172 tripartite motif-containing 17 Gene [Source:MGI (curated);Acc:Trim17-002]

 
Come back to gene ENSMUSG00000036964


For any suggestions or comments, please send an email to unitrap@crg.es