Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST245909
Clone ID OST245909
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST245909
Sequence
ATATGTAAAAGCTGACTTCCTGAAAGAACGCTTGGCCGCAGGTCTATGCGCAAGCATGCTGAAAAGGAGCGGCTCCGAGA
GGCACAGCGTGCGGNCACACACATTCCTGCCGCTGGGGATGCCAAGTCCATCATCACATGCAGGGTGTCCCTTCTGGACG
GNACANATGTCAGNGTGGACTTGCCGAAAAAAGCCAAAGGACAGGAGCCTGNTTGACCAAATNATGTATCACCTGGACTT
GATTGAAAGTGACTATTTTGGTTTGAGATTCATGGATTCANCCCAAGTAGCCCATTGGTTGGATGGNACAAAAAGCATCA
AAAAGCAAGTAAAAATTGGTTCACCCTATTGTNCTTCATCTTCGAGTTAANNGTTTATTCCTNGGAACCAAATAATNTTN
CGTGAGGAGCTAACCCGG
Sequence Type mRNA
Unitrap ID UNI23755

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 121518462..121539235 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026383 (Epb4.1l5) NM_145506 erythrocyte protein band 4.1-like 5 Gene [Source:MGI Symbol;Acc:MGI:103006]

 
Come back to gene ENSMUSG00000026383


For any suggestions or comments, please send an email to unitrap@crg.es