Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST245876
Clone ID OST245876
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST245876
Sequence
TGTGGACATTCTCAGCCCTTAAGATGTGGAAATTTAGCCAGAGCTCACAGCATGCCGTGGAGGTTGCCGACAGGACACCA
ACTCTGCAGACTGTGTCTTCTCAGAAAGCCGCGACCAGCTCTGAAAATCAAACCCTCTTCAGCTTGTGTCACCTACGGAA
CCGGACAGCCAGTCAGATAAAGAAAACAAGAGAACCGGTGGAAAAGCTCAGTGCATGTTCAGTTGACATTAGAAAAATCC
GCAGGCTGAAAGGATGGGTGCTTCTAGAGGAAGAAACCTACGTTGAAGAGATTGCAAATATTTTGAAAGAACTAGGTGCC
AATAAAACTGTGATTGCCAGTATATTAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI16861

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 84583207..84583553 336
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049038 (Mterfd3) NM_028832 MTERF domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1921488]

 
Come back to gene ENSMUSG00000049038


For any suggestions or comments, please send an email to unitrap@crg.es