Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST245770
Clone ID OST245770
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST245770
Sequence
GAACTGAGTATTTCTCAGAGATTGATGGAAACAGAAACCAAAACTCTTCCCCTGGAGAATGCATCCATCCTTTCAGAGGG
CTCTCTACAAGAAGGACACCGATTATGGATTGGCAACCTGGATCCCAAAATCACAGAATACCACCTCCTCAAGCTCCTCC
AGAAGTTTGGCAAGGTGAAGCAGTTTGACTTCCTCTTCCATAAGTCGGGTGCTTTGGAGGGCCAGCCCCGAGGGTACTGT
TTTGTTAACTTTGAAACTAAGCAGNNNNNNGNNCAAGNNNTNCNTTGNATNANNGGCAAGCNGGANCTNTCTNANANNCT
GGGNNANNGACNNCCCCCTCCTNANGCNAANACATGTGANCATANCTNGAATTATANCCATCCTTGCCATTATATCTTGA
GCCNTCANTCAAGCACATGAGCTC
Sequence Type mRNA
Unitrap ID UNI23628

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 35982645..35989785 132
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026889 (Rbm18) NM_026434 RNA binding motif protein 18 Gene [Source:MGI (curated);Acc:Rbm18-001]

 
Come back to gene ENSMUSG00000026889


For any suggestions or comments, please send an email to unitrap@crg.es