Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST245752
Clone ID OST245752
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST245752
Sequence
TGCGAGATGATGGCTTCCAACCGACCATTCTTCGAAGTGGAGATGTCTATGGTTATAGTTCATGCACAGCCAGCCCCCCC
AGCCAGACAAAGCTACAAGCTCGTACCATCAACCCACCTGCCACGTCACTTCCCAAAACTGCTGTGTCAGTCCCTGCAGG
CCGGACCACCTTGCTCCCTGTGCCACTGTCTGGCAGGCTGGCTAAAGGGTCCACAGCAGCCCTAGCCAAGCATGCCACCA
CTAACCTGCTGCTGAGCTCCCTGAAGCAGTCGAGTGCCAGCAACAGCAGTGGTACAACAGTAGGCTTCCCTGCCCACCTA
TATCCAGGCGTCTACCCAACCATGCGGCTTTCTGTGGTCCTTGAAGCACTGGTCCCACTCAAGACTNCCTGCTTGGATGT
TAAGCACGGAGCACAGTCACTGCGTTTCTTTCCACAAG
Sequence Type mRNA
Unitrap ID UNI20144

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108365484..108365906 411
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049305 (Ccdc71) NM_133744 coiled-coil domain containing 71 Gene [Source:MGI Symbol;Acc:MGI:1919704]

 
Come back to gene ENSMUSG00000049305


For any suggestions or comments, please send an email to unitrap@crg.es