Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSI829
Clone ID CSI829
Vector pGT0Lxf
Project baygenomics

Sequence tag CSI829
Sequence
TTGTGAGCTCTTCTAGATGGGGGCTGTCGGGTGTCATGGGCGGTGGCGGCGGTACCGCCTCCGCGTCTCCCTGAGCTGGA
CCTCACGGGGGACTCTGCGCCAAGCTGGGCGATGGATGAGAGCAGCGAGCTGGGCGTTCTGGAGACCATGGAGACCCTCA
CGGAGCTGGGCGATGAGCTGACTCTCGGGGACATCGAC
Sequence Type mRNA
Unitrap ID UNI5488

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 81977723..81977919 183
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022463 (Srebf2) NM_033218 sterol regulatory element binding factor 2 Gene [Source:MGI Symbol;Acc:MGI:107585]

 
Come back to gene ENSMUSG00000022463


For any suggestions or comments, please send an email to unitrap@crg.es