Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST245657
Clone ID OST245657
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST245657
Sequence
CCTTCTTGTTGGAAACCATGTGTTGAAATCCGGTCTGGGTCGAATTACTGAGAACACATCTCAGTACCAGGCAGNGGTTG
TCTATTCCATGGCGGACATTCCTCTGGGTTTTGGGGTGGCAGCAAAGTCTACCCAAGACTGCCGAAAAGTGGACCCCATG
GCAATTGTGGNGTTCCACCAAGCANACATTGGGGAGTACGTACGCCATGAANAGACACTGACTTAGGACGGNCNTTCCAA
GAACATTTTGCTGTGTGAGAGGACTTAGCTTTGTTTCCTGTGNGCGGCCATCAGATTAAATCTGGACAACACTGAGATAC
GCAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI17883

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109581981..109582494 207
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031917 (Nip7) NM_025391 nuclear import 7 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1913414]

 
Come back to gene ENSMUSG00000031917


For any suggestions or comments, please send an email to unitrap@crg.es