Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CJ0507
Clone ID CJ0507
Vector pGT0lxrT2
Project sanger

Sequence tag CJ0507
Sequence
CTATTCCCCGCCTCTTGTATCTTGAACCGCTTCTCCCTGAGCTCAGGCGGCGTTTTCCGATCCTGCTGCGGTCTAGGTGG
CGTTTCTGTCCGGCCACGAGAGACTGTATAGCCCCGCCGCCCGCGGGCAATGGTGCGGCGGAGCGCGCAGACGCGGGCGG
CCCTGCGGTGGGTATGAAAGGAGGATGGAAGGGCAGGACGAGGTGTCGGCGCGGGAGCAGCATTTCCACAGCCAAGTGCG
AGAGTCCACGGAACCCAGAGGCCTCTCCCGTGGTCTCGCCTTTTTTGTCTTTGCCACTTAAAGTAGATAGGCACAGGAAT
TTTATGCCGGGTCGCGCGGCGTGGATTGACGGAGGAGGAATATGGGAGACAAGTGCGAGAGTCCACG
Sequence Type mRNA
Unitrap ID UNI489

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 29704666..29704914 247
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000010721 (Lmbr1) NM_020295 limb region 1 Gene [Source:MGI Symbol;Acc:MGI:1861746]

 
Come back to gene ENSMUSG00000010721


For any suggestions or comments, please send an email to unitrap@crg.es