Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST244168
Clone ID OST244168
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST244168
Sequence
CTAATACACTGTGGAGGTGGGGAGTCCAGAACCCTCCCANACAACAGCACCTCTGGAGCTCCTGGTCACTAGGAATTGTA
ATTCACGAGGAACTTCATCAATCGCATGTCTGACGACATCGCCATCCTGAAGCTCAAGTATCCTGTCACTTGGTCCCCCC
TCGTCCAGCCAATCTGTCTCCCCTCATTCAATTTAAAGCCAAGCATTGGAACCATGTGCTGGGTCGTCGGGTGGGGACTT
GAAAAGGCCGAAGGGCACCCAAAGACTCCCTATAGTGTCCAAGGTTTGGCTGTCAGGATTGTGAACAATGAAATCTGCAA
TCATCGGTACCAGTTCCTCCTGCTGAAGAACCAGAAAAAGTTCATTGGGAACGACATGTTGTGTACAAGCTCAGAATGGG
GCCTGGACACTTGNCAGGACACCTCCGGAAGCTCTCTGGTTGGCCAGATGAACAAGACCTGGGTCCAGA
Sequence Type mRNA
Unitrap ID UNI23811

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110752517..110758555 228
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049719 (1700112C13Rik) NM_183103 RIKEN cDNA 1700112C13 gene Gene [Source:MGI Symbol;Acc:MGI:1921556]

 
Come back to gene ENSMUSG00000049719


For any suggestions or comments, please send an email to unitrap@crg.es