Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CJ0412
Clone ID CJ0412
Vector pGT0lxrT2
Project sanger

Sequence tag CJ0412
Sequence
AGAAGAAAGTCCGGCCCCGCTCTTCTCAGAGCGAGAAGGTAGGGAGCAGCAGCAGGGAGTTGACTAGAAGTAAGAAAGTG
ACCCGTAGCAAGAACGTGACCGGGACCCAGGTAGAGGAGGTGACCAAGATCGAGGAGGCGACCCAAACCGAGGAAGTAAC
TGTGGCAGAAGAGGTGACCCAGACCGACAACATGGCCAAGACCGAGGAGATGGTCCAGACGGAGGAAATGGAAACACCCA
GACTCAGCGTGATCGTCACCCACAGCAATGAGAGGTATGACCTTCTTGTTACCCCACAGCAAGGTAACAGTGAGCCAGTT
GTCCAAGACTTGGCTCAGCTTGTTGAAGAGGCCACAGGAGTTCCACTACCTTTTCAGAAGCTCATATTTAAGGGAAAATC
TCTGAAAGAAATGGAAACACCGTTGTCAGCACTTGGAATGCAAAATGGTTGCCGAGTCATGTTAATTGGTGAAAAG
Sequence Type mRNA
Unitrap ID UNI490

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 40890658..40895018 265
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028416 (Bag1) NM_009736 BCL2-associated athanogene 1 Gene [Source:MGI (curated);Acc:Bag1-001]

 
Come back to gene ENSMUSG00000028416


For any suggestions or comments, please send an email to unitrap@crg.es