Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST243994
Clone ID OST243994
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST243994
Sequence
AGTGGAGAATACCAGCAAANCCGCCTGTCAGCTTTTTCTCCTCGAAATCTCCGGTCCTTGACCTCTTCCAGGGGCAGCTG
GGACTATGCTGACCATGTCCGCCAGGGATTCTGAGGTGGTGGTGCTGTTCTTCTATGCCCCGTGGTGTGGCCAGTCCATC
GCTGCCAGGGCAGAAATTGAGCAGGCAGCCAGCCGGCTTTCTGATCAGGTGTTGTTTGTGGCAATAAACTGTTGGTGGAA
CCAGGGGAAATGCAGAAAACAGAAGCATTTCTTCTATTTTCCTGTGATACATCTGTATCATCGGAGTTTTGGACCAATCG
AATACAAAGGCCCCATGAGTGCTGTTTACATTGAGAAGTTTGTCCGCCGGGCGATGAAGCCGCTTCTCTACATCCCGTCT
CAATCAGCATTGCTAGACTTTCTCTCCAGCTATGAGAAGCAACAGGCCACCC
Sequence Type mRNA
Unitrap ID UNI23816

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 11106349..11128781 194
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022498 (Txndc11) NM_029582 thioredoxin domain containing 11 Gene [Source:MGI (curated);Acc:Txndc11-001]

 
Come back to gene ENSMUSG00000022498


For any suggestions or comments, please send an email to unitrap@crg.es