Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSI715
Clone ID CSI715
Vector pGT0Lxf
Project baygenomics

Sequence tag CSI715
Sequence
AGAAGGTTTTTTTCAGGAAAGGATTATACCAAAGTGGACCGTTCAGCTGCTTATGCTGCTCGTTGGGTGGCAAAATCCCT
TGTTAAAGGAGGTCTGTGCAGGAGGGTTCTTGTTCAGGTCTGTTATGCTATTGGAGTTTCTCATCCATTGTCGATCTCCA
TTTTCCAATATGGCACTTCTCAGAAGAGTGAGAGAGAGATACTAGAAAAAGTAAAGAAGAATCTTGACGATCTTCCTGAG
GCCGATAGATGTTCTGTGAGGAGTATACTAGATGGTTGTGAGCTCTTCTAGATGGCCGACATTGACAA
Sequence Type mRNA
Unitrap ID UNI5645

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 72384985..72385307 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053907 (Mat2a) NM_145569 methionine adenosyltransferase II, alpha Gene [Source:MGI Symbol;Acc:MGI:2443731]

 
Come back to gene ENSMUSG00000053907


For any suggestions or comments, please send an email to unitrap@crg.es