Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST243308
Clone ID OST243308
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST243308
Sequence
TCAGCGCATTGGCGCCTGTTATGNACTTCGTAGNGCCCAAATATCAGTGTGCCCTCCATGTCCTTTGTTGAAGATGTCAC
CATAGGCAGNAAGGGGAGTCAATACCCCCTGATACCCAGTTCATAAAAACTTGGCGGNATACAGGAATTCTGGAGCAGAG
GCCTGGCCTCCAGGGGTTTGTCTTAAATATGTCGGGGGAGACCAGTTTGGACATGTGAACATGGTGATGGNGAGATCACT
AGAGCCCCAAGAGATCGCAGACGTCAGCGTCCAGATGTGCAGTCCCAGCAGAGCAGGCATGTACCAGGGACAGTGGCGGA
TGTGCACTGCTACTGGACTCTACTATGGAGATGTCATCTGGGTGATTCTCAGTGTGGAGGTGGGTGGACTTTTAGGAGTA
ACGCAGCAGCTGTCATCTTTTGAAACGGAATTCAACACACAGCCACATCGNAAGGNAGAAGGAAACTTNNACCCGTTTGC
CTCTCCCCAAAAGANCCGACAATCAGATGAAAACAACCTAACAGAACCCTGGGGGTTCCGAGTTCGACTNGATCAGNAAA
AAATACATGGGCTCCTGTTCCTGAGCAAAGCGAGCAAGAAT
Sequence Type mRNA
Unitrap ID UNI6766

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27904938..27930997 229
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056692 (D17Wsu92e) NM_001044719 Uncharacterized protein C6orf106 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q3TT38]

 
Come back to gene ENSMUSG00000056692


For any suggestions or comments, please send an email to unitrap@crg.es