Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST243177
Clone ID OST243177
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST243177
Sequence
ATTCTGTTCAGCGGAGCTTTTAGCCCCAGCCCCACAGAAGTTTNCATTTAAAAAATTATCTGTCAAACCAGGGAAGTGGA
GGCCCAGGCCTTTAATCCCAGCACTAAGGNAAGCAGTAGGCAGAAGGTTCTCGGAAGTCACCTTTGTGTGACTGTATGGC
CTCAAGATGGCAGTCACCTTCATTGGAAACAGCACAGCCATCCAGGAGCTGTTCAAGCGCATCTCTGAGCAGTTTACGGC
TATGTTCCGCCGGAAGGCTTTCCTCCACTGGTACACGGGTGAGGGCATGGACGAGATGGAGTTCACCGAAGCTGAGAGCA
ACATGAACGACCTCGTCTCTGAGTACCAGCAGTACCAGGATGCCACCGCGGAAGAGGAAGAGGATTTCGGAGAGGAGGCA
GAAGAGGAGGCCTAAGGCAGAGAGCCCTGCATCAGCTCAGGCTGCTTAGATCCCTCAGCTTTCTCCAACTGCCCTTTGTC
CTCCAGNTTCTTTCTGCTGCCTNTGTCTTGTATTTGTTTTGNTCTGTTTTCTTATTGGGGNNAAATGGTGCCTGGCACAT
GGCAGGCAC
Sequence Type mRNA
Unitrap ID UNI21704

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35971773..35972185 397
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001525 (Tubb5) NM_011655 tubulin, beta 5 Gene [Source:MGI (curated);Acc:Tubb5-001]

 
Come back to gene ENSMUSG00000001525


For any suggestions or comments, please send an email to unitrap@crg.es