Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST242927
Clone ID OST242927
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST242927
Sequence
ATTTCGTCTGACCAACCTACGGCTGGGAGGATGCTGGNATATTATACCTGTGAATACTATCCAAAGGGAATCCTCTTATG
GAATCTCACTTTCCAGTGACAGTCTCTTACTATTGGTCACAGGATACTTGTATAAGCCTTCCCTCTGAGTCCATCACTCC
GGCCTGATAACCACAGGAGAAAAGGCCCCACAGCACCCCTGGGCCACCATGAACCATTGGTCAAAGTGGACAAGCTGCTC
TTCAGTTTTCTGTGAAGCCTGTACTGCTCTTTGAAAGCTCCTGGGATGGGGTGACAGCTCCATCTCTTTGTTCCTTATAT
GGTACAGAGGACAGAACTCAGCACAGATGCTCGCCANATACGTCACCGTTTTACAATTACTGCACTGAAAACTNCAACCC
TATTTTTCCCTACAGATCAGGCGTACTGCCTAGAGCATAAACCAAAGCCTAGGTGCTTTGCATCTGTTCCTGAGNTCATA
ATTATGTTAGTATGACCCATAAGGCTTTATTTTATAANTTTCTTTAGAATGNATTTTGGGGGCTACCCCGGGGNATTCCN
GGGNACTATGGATGGATATACAAATTAGGNACTTTTTTTTTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI23838

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3510312..3516352 373
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078814 (CAAA01093111.1.1.7497)  

 
Come back to gene ENSMUSG00000078814


For any suggestions or comments, please send an email to unitrap@crg.es