Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST242569
Clone ID OST242569
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST242569
Sequence
TGTCTAATAAATACTACATNAATTGGCANATGAATNGACTGAATNAACNAGCTNAANTTCCACAAGGAGTTCCTGGAGTT
NCCGAAGGAACGGAGCAAGATGCTGCCTGNNCTNGAGAAACCAGTNGNTACATGGAGNGCAGCTTCTGGAATGAGCCACA
GCCCCGAGCTGGCCCCAATATCTATGAGCTGAGGACATATAAACTCAAGCCAGGAACCATGATTGAATGGGGAAACAACT
GGGCTCGGGCCATCAAGTACCGNCAGGAGAACCANGAGGCGGTGGGAGGCTTCTTTTCACAAATAGGAAAGCTCTACGTG
GTACACCACTTATGGGCCTACAAAGAT
Sequence Type mRNA
Unitrap ID UNI23850

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4789091..4789989 114
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034285 (Nipsnap1) NM_008698 4-nitrophenylphosphatase domain and non-neuronal SNAP25-like protein homolog 1 (C. elegans) Gene [Source:MGI (curated);Acc:Nipsnap1-001]

 
Come back to gene ENSMUSG00000034285


For any suggestions or comments, please send an email to unitrap@crg.es