Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSI619
Clone ID CSI619
Vector pGT0Lxf
Project baygenomics

Sequence tag CSI619
Sequence
AGCAAGAAGGGTGTCAGGAAACAGGGTGACATCAGCTGAGCAAGTTGTCCCCAGCCTAGACACACCAGAGGGTGCTGTGC
CCTGTGAGACACCCTCCGTCAGGGACAGAAGCAACCAGCTTCCTGGGAGGAGTCATGGCTTCCACAGACCAAATCTAGTC
ACAGGAAAGGGACTCAGGAGCAAGGTGGCTGAGCAGGAGGTCCAGACAATCCATGAAGAGAATGTAGCAAGACTACAAGC
CATGGATCCTGAGGAGATCCTGAAGGAGCAGCAACAGTTACTGGCTCAACTCGACCCCAGCTTGGTTGCCTTCTTGAGAT
CTCATAGCCAGGTCCAGGAACAAACAGGAACAAAGGCCACCAAGAAGCAGAGTCCAGAGAGACCCTCAGTTCTTGTCACT
AAAGAAGAGCCTGTCACATCAACTCGTACAAGGGAGCCTAGGACTGGGGACAAGCTGGAAGAAAAGCCGGAGGCCACGGT
GGAGGACAAAATGGAAGACAAGCTGCAGCCAAGAACC
Sequence Type mRNA
Unitrap ID UNI5665

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 119602406..119605862 219
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034032 (Rpap1) NM_177294 RNA polymerase II associated protein 1 Gene [Source:MGI (curated);Acc:Rpap1-006]

 
Come back to gene ENSMUSG00000034032


For any suggestions or comments, please send an email to unitrap@crg.es