Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST242032
Clone ID OST242032
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST242032
Sequence
TGAGGTAGAAAATGTTTACCCTCNACCTGGCTGGGTTGAAATCGATCCTGATTCTCTCTGGGCTCAGTTTGTTGCCGTAA
TAAAAGATGCTGTCAAAGCTGCAGGGGTGCAGATGAATCAAATTGTCGAAAAAAA
Sequence Type mRNA
Unitrap ID UNI23867

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 96029418..96033837 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041440 (Gk5) NP_796326 glycerol kinase 5 (putative) Gene [Source:MGI (curated);Acc:Gk5-001]

 
Come back to gene ENSMUSG00000041440


For any suggestions or comments, please send an email to unitrap@crg.es