Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST241781
Clone ID OST241781
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST241781
Sequence
TGAGCCGTGGCGCTAGGATGGGTAACAAGNGCTCTCCGTGCTCATGTGGAAACAGCGCAGGAANACTGGNGTCTTTCAGC
TTAAAGACCGTGGTCTGACCGAGTTCCCCTCAGAGTTGCAGAAGCTGACANGCAATCTTAGGACCATCGATTTATCCNNC
AACAAGATCGACAGCCTACCGCCTCTGATAATAGGAAAGTTCACTCTGCTAANGAGCCTCTNCCTCANCANCAACAAACT
GACTGTTCTACCTGANGAATTATGCAATCTGAAANANCTAGAGACACTAAGTCTCAACAACAATCACCTGAGAGAGCTAC
CATCTACCTTTGGGCAGTTGTCAGCCCTGAAGACGCTGAGCCTCTCTGGGANTCAGCTGGGAGCATTACCCCCCCAGCTT
TGTTGCCTGAGACATCTAGATGTAGTAGANCTCTCTAAAAACCAGANTCGGAGTATACCTGACACAGTTGGGGAGCTGCA
GGCCATCGAACTCAATCTCAACCAGAACCAGATCTCTCAGCTCTCTGTGAAGATATCCTGCTGTCCTCGCCTCANGGTCC
TCCGGCTGGAAGAGANCTGCCTTGAGCTCAGCATGCTT
Sequence Type mRNA
Unitrap ID UNI23877

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 120431783..120434754 256
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027286 (Lrrc57) NM_025657 leucine rich repeat containing 57 Gene [Source:MGI (curated);Acc:Lrrc57-003]

 
Come back to gene ENSMUSG00000027286


For any suggestions or comments, please send an email to unitrap@crg.es