Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST241683
Clone ID OST241683
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST241683
Sequence
TTTACTAGTTTGGTGTTTAAAGTATGTCATACATGGCAAAATTTCGAACAGGACCTGCATCCTTTTGTCACTTTTTATTC
TATTTATTTTTTCTGCTGATGATGGGCTTAAAGATGCTGTGGCCAAACGCAGCATCCTTTGGACCTCCTTTTGGACTTGA
CCTCCTTCCAGAACTTCATCCACTAAATGCGCATTCGGGAAACAAAGCTGACTTCCAAAGGAGTGATAGAATCAACATGG
AAACAAACACCAAGGCTTTAAAAGGCGCTGGCATGACTGTGCTGCCAGCCAAAGCCTCTGAGGTGAACCTGGAAGAACTA
CCTCCTCTGAATTACTTTTTACATGCATTTTATTACAGTTGGTATGGAAATCCACAGTTTGATGGTAAATATATACACTG
GAATCATCCGGTCCTGGAACACTGGGACCCTCGGATAGCCAAGAACTATCCACAAGGACAACATAGTCCTCCAGACGACA
TTGGCTCCAGTTTTTATCCTGAGTTAGGAAGTTACAGCTCTCGAGACCCTTCTGTCATAGAAACTCACATGAAACAAATG
CGCTCAGCCTCAATTGGTTGGGAATTATTTTATTTTATTTATTTATGNGTATATAAATAATTCTGGTGGACAA
Sequence Type mRNA
Unitrap ID UNI23880

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 26267507..26268138 614
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040520 (Manea) NM_172865 mannosidase, endo-alpha Gene [Source:MGI (curated);Acc:Manea-001]

 
Come back to gene ENSMUSG00000040520


For any suggestions or comments, please send an email to unitrap@crg.es