Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST241590
Clone ID OST241590
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST241590
Sequence
AACTTCCTCGGCCTGGCAACAGTCTGCTTGGGACCAAACAAGNCCAGGTAGTGCCGCCATGTTCTCCAAGACAGGNCAGC
ACAGNAGGGCCCACACTCTGCTCGCCCCGCCCTCTGCCAGCAATGCCACCTTTGCCCGGGTACCTGTGGCAACTTACACC
AACTCCTCACAGCCCTTCCGACTGGGAGAGCGCAGCTTTAACCGGCAGTACGCCCATATTTATGCCACCCGCCTCATCCA
GATGAGACCGTTCCTGGTGAGCCGGGCGCAGCAACACTGGGGCAGCCGAGTTGAAGTGAAGAAGTTGTGTGAGCTGCAGC
CTGGGGAGCAGTGCTGTGTGGTGGGCACGCTGTTCAAAGCCATGTCCCTCCAACCCTCCATCCTGCGGGAGATCAGCGAG
GAGCACAACCTGGTCCCCCAGCCTCCACGGAGCAAATATATCCACCCGGATGACGAGCTGGTCTTAGAAGATGAGCTGCA
GCGTATCAAACTGAAAGGCACCATTGATGTGTCAAAGCTGGTCACAGGAACGGTCTTGGCCGTGTTGGGCTCTGCGAAAG
ATGACGGGAGGTTTCAGGTTGAAGACCACTGCTTTGCTGACCTGG
Sequence Type mRNA
Unitrap ID UNI13715

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 5774355..5776985 244
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020471 (Pold2) NM_008894 polymerase (DNA directed), delta 2, regulatory subunit Gene [Source:MGI (curated);Acc:Pold2-001]

 
Come back to gene ENSMUSG00000020471


For any suggestions or comments, please send an email to unitrap@crg.es