Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CSI556
Clone ID CSI556
Vector pGT0Lxf
Project baygenomics

Sequence tag CSI556
Sequence
TTTGGTTTTTTTTTTTTTTTTTGCGGGAGGAAGCTGCGGCAGCTCCATGGCCCAGGCGTGCTGAGGGACACGGCTCTGGC
TTCAGCCCGGCAGCGGCCGAACAATGAAGCTCTTGAAGCCAACTTGGGTCAACCACAAT
Sequence Type mRNA
Unitrap ID UNI5682

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 18877495..18877611 115
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022702 (Hira) NM_010435 histone cell cycle regulation defective homolog A (S. cerevisiae) Gene [Source:MGI (curated);Acc:Hira-001]

 
Come back to gene ENSMUSG00000022702


For any suggestions or comments, please send an email to unitrap@crg.es