Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CH0841
Clone ID CH0841
Vector pGT0lxr
Project sanger

Sequence tag CH0841
Sequence
GAAGAGGGCCGAGAAGAGGGGAGCGAGAGTGGCAGAGTAGAGTAAAGAATGAAGGGATGGGGAAATATATAGAGGAGTTC
GGAGGGACAGCCAAGAGTAAGGAGAATCGAGGAACAAAGATAACTAGCAGATAGGGGACGGGGGAGAACCATCAAATAGG
AGAATGTAGAGGCCGATACAAAGTGATAGAAATGGGAGAGGGGAAAAGTAGGGAAAGAAAAAGGGAAGGTCCTGAGGTGT
AGTTGGAGTAGATTGTGCCTTCTGAAGCGATACCTGTTTACAATGAAGTTGCAGTCCCCAGAATTCCAGTCCCTTTTCAC
CGAAGGATTGAAGAGCCTGACAGAATTATTTGCCAAAGAGAATCATGAATTAAGAATAGCAGGAGGAGCAGTGAGGGATT
TAATGAATGGGGTGAAGCCTCAAGATGTGGATTTCGCCACCAATGCCACTCATACTCAGATGAAGGAGATGTTCCAGTCA
GCTGGCATTCGCATGATCTACAACAAAGGAGAGAAACATGGGACTATCACTGCCAGG
Sequence Type mRNA
Unitrap ID UNI498

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 106719878..106723472 187
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013736 (Trnt1) NM_027296 tRNA nucleotidyl transferase, CCA-adding, 1 Gene [Source:MGI (curated);Acc:Trnt1-001]

 
Come back to gene ENSMUSG00000013736


For any suggestions or comments, please send an email to unitrap@crg.es