Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST241124
Clone ID OST241124
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST241124
Sequence
AGTCTGCTCACCCCTGNAAAGTGATGGCNATTCTTCACAGNAGNAGAAATTGGTTGCTGCAATACTCCGCAACCGATCAC
TTGTGGAAGAAGGANGACCAGCACTTGAAACTGTGCCTTGGAAGTGAAATGGGCCTCTCTTCCCATTTGCAGTCTTGCAA
GGCAGGAAGTACACGCATNTTTACCAGCAACAGCCACAGTTCTGTGGTGTTACAGGGCTTTGACCAGCTTCGGCTTGATG
GATTGCTTTGNGATGNGACACTGATGCCAGGTGATACAGATGATGCTTACCCTGTGCACAGAGNCATGATGGCATCTGCT
AGTGACTACTTCAAAGCTATGTTCACAGGTGGAATGAAAGAACANGAGCTGATGTGCATTAAGCTTCATGGCGTGAGCAG
AGTGGGTCTACGGAAAATTATTGATTTCATCTATACTGCAAAGCTTTCTCTTAACATGGGACACCCCTTCAGGATACGCT
GGAAGCCCGCANCTTTCTTNAAAATTCTTCCGGTTTTAAGACTTCTGNAAANCGTTTCTCAATCTGGGGGNCACNTTTGN
ATAACTNTGGTTGAAAGTTGGACCGGATTGCCAAC
Sequence Type mRNA
Unitrap ID UNI23895

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 22824486..22892327 166
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036782 (Klhl13) NM_026167 kelch-like 13 (Drosophila) Gene [Source:MGI (curated);Acc:Klhl13-001]

 
Come back to gene ENSMUSG00000036782


For any suggestions or comments, please send an email to unitrap@crg.es