Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST240838
Clone ID OST240838
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST240838
Sequence
TACCCATGGGGACCTATTTTACTTNCGAGGCCGNNGGNNNAAATGGGCCATTGAGCTGAGTGGGCCGGGAGGAGGCAGCA
GGGGCCGAAGTGACCGGGGCAGTGGACAGGGAGACTCCCTCTATCCAGTCGGTTACTTGGACAAGCAAGTGCCTGATACC
AGCGTGCAAGAGACCGACCGGATCCTGGTGGAGAAGCGCTGCTGGGACATCGCCTTGGGTCCCCTCAAGCAGATTCCCAT
GAACCTCTTCATCATGTACATGGCAGGCAACACCATTTCCATCTTCCCTACTATGATGGTGTGTATGATGGCCTGGCGAC
CCATTCAAGCACTTATGGCCATTTCAGCCACTTTCAAGATGCTGGAGAGTTCAAGTCAGAAGTTTCTTCAAGGCTTGGTC
TATCTCATTGGGAACCTGATGGGTTTGGCATTGGCAGTTTACAAGTGCCAGTCCATGGGACTGTTGC
Sequence Type mRNA
Unitrap ID UNI18912

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 112203993..112208055 156
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027131 (Tmem85) NM_026519 transmembrane protein 85 Gene [Source:MGI (curated);Acc:Tmem85-001]

 
Come back to gene ENSMUSG00000027131


For any suggestions or comments, please send an email to unitrap@crg.es