Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST240638
Clone ID OST240638
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST240638
Sequence
ACATACAAGCTGAAGCACCATTTTGCAAAATTCTAGTAAGTCATGGTAAGGCATGAAAGCAAGTTGTTCTGCAGAGCAAC
TCTCTGAGTTTATTCACTGNGGTAAAGCCTTTGCATATGAGAGTGGTAGTCAAAGGCATCAAATAAAACATACTGGAGAG
AAACACCATGACTGTAAAATAAAAA
Sequence Type mRNA
Unitrap ID UNI23911

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177354873..177355000 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078865 (OTTMUSG00000016574) predicted gene, OTTMUSG00000016574 Gene [Source:MGI Symbol;Acc:MGI:3649838]

 
Come back to gene ENSMUSG00000078865


For any suggestions or comments, please send an email to unitrap@crg.es