Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST240540
Clone ID OST240540
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST240540
Sequence
ATCAGCTGTGTAAGTGACGTCAGCGTCATGGNACTGTCAAGATCGGNANNANAGCGCCCAGNAAAACAGNACTCACAGGT
CCTTTCAGGNAACCAGACGGNACTCCCAGNAGGCCGGAGGTGAAGATGGACTCTCTGAAAGCTTCCAGCTTCTGCAGGTG
GATGTGGAGTACGAGCGCCCAGAAGAGACCAGCCCTGCAAACAGTGCCGTGTGGAGCTCGNNANGCGCTGCGTGAAAGCT
CAGTCNNTGCTGNGNGCTTGTCNNGNTGGCTNNCNCNNAGATCTNTGCTCTAAGNGANGATNTANGAGCCTGACGATGCA
ATGCTATCNNTTTAATTGCCTCTGGCATNACAGCTCACCTCTTCNCTTTTGATGAATGCCTNATGCCAATAAGAATCTTT
NGGANACCAAACACTCAGGACCAAGACTATGTGTTGACTTGAGCATGACCCAGCACATGTCAAAGAAGGAATTGAGTAGG
TTGGCGGGACAGATTCGAAGGTTGTATGGTTCGAACAAAAAAGCCAGCAGGCCCTTTTGGATCTGCCTTACTGGATTCTC
AACTGCCAGCCCCCTCTATGAGGAGTGTCTGAGGATGAACGACGGGTTTTCTGCTTACTTGCTGGATGTGACAGAAGAAG
ACTGCTTTAGCCTTTA
Sequence Type mRNA
Unitrap ID UNI23916

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 45313291..45320797 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035601 (Rg9mtd3) NM_027266 RNA (guanine-9-) methyltransferase domain containing 3 Gene [Source:MGI (curated);Acc:Rg9mtd3-001]

 
Come back to gene ENSMUSG00000035601


For any suggestions or comments, please send an email to unitrap@crg.es