Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST240470
Clone ID OST240470
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST240470
Sequence
ACCTGAGGTTGGTTTGCCTNCCCAAATGCAGAGCTGAGGGGCTTTATAGATNTGAATTTCAGTCCAACGAAAGGTAACAT
TTCACTTGTTGCCTTTCCAGTTTCAAGCACCAACTCACCAACAAAGATTTTACCGAAAACCTTAGGGCCAATAAATGTGA
ATGTTGGACCCCAAATGATTATAAGCACACCGCAGAGAATTGCCAATTCAGGAAGTGTTCTGATTGGGAATCCATATACC
CCTGCACCCGCAATGGTCACTCAGACTCACATAGCTGAGGCTGCTGGCTGGGTTCCCAGTAAACGAAGCAAAAAAGGAGA
TAAAAATGGGAAAGGCTTGAGACATTTTTCAATGAAGGTGTGTGAGAAAGTTCAGCGGAAAGGCACAACGTCATACAATG
AGGTAGCTGATGAGCTGGTATCTGAGTTTACCAACTCAAATAACCATCTGGCAGCTGATTCGATCGAGAAGCAGAGGCGG
ATAGAACGGATAAAGCAGAAGCGAGCCCAGCTACAAGAACTTCTCCTTCAGCAAATTGCTTTTAAAAACCTGGTACAGAG
AAATCGACAAAATGAACAACAAAACCAGGGCCCTCCAGCTGTGAATTCCACCATTC
Sequence Type mRNA
Unitrap ID UNI13152

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 96133099..96207303 165
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032411 (Tfdp2) NM_178667 transcription factor Dp 2 Gene [Source:MGI Symbol;Acc:MGI:107167]

 
Come back to gene ENSMUSG00000032411


For any suggestions or comments, please send an email to unitrap@crg.es