Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST240345
Clone ID OST240345
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST240345
Sequence
ACCTGAGGAGTGAAGATAGTCCAGNNCCTAAGAGACAGCGCCTCTCTCATTCAGTCTTTGATTATACATCAGCATCACCA
GCTCCCTCACCACCAATGCGACCATGGGAGATGACATCAAATAGGCAGCCCCCTTCAGTTCGACCAAATCAACATCACTT
CTCAGGGGAACGCTGTAACACACCTGCACGCAACAGAAGAAGTCCTCCTGTTAGGCGTCAGCGAGGAAGAAGGGAACGTC
TGTCTCGACATAATTCCATTAGTCAAGATGAAAACTATCACCATCTCCCTTATGCACAGCAGCAAGCAATAGAGGAACCT
CGAGCCTTCCACCCTCCGAATGTATCTCCCCGTCTGTTACATCCAGCTGCCCATCCCCCCCAGCAGAATGCAGTCATGGT
TGACATACATGATCAGGTACANNTACNNANTGNCCTGGAACTNCNTGNGGTAAAAGNTAACGGTGNCTAANGNGGATCTA
TCGANNTGNGGGGCTTGTTGCNNGNTCCTNNAATTCCTGAAGTGCANCNAGNTTGNGTGGNNCCNTNCTTTNANNAANGG
AAATTTAGCCAGGGTNTGTGGCACATAACTTGAACATTGTNTCAATGAATGAATGAGAGAA
Sequence Type mRNA
Unitrap ID UNI19451

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 44161693..44165426 311
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035696 (Rnf38) NM_001038993 ring finger protein 38 Gene [Source:MGI (curated);Acc:Rnf38-017]

 
Come back to gene ENSMUSG00000035696


For any suggestions or comments, please send an email to unitrap@crg.es