Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST240320
Clone ID OST240320
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST240320
Sequence
ACCTGAGCGTCCCGGGCTCCCGNGTGTCTCCCATGGCGGATACGACCCCGAACGGCCCCCAAGGGGCGGGCGCTGTGCAA
TTCATGATGACCAATAAATTGGACACAGCAATGTGGCTTTCTCGCCTGTTCACAGTTTATTGCTCCGCTCTGTTCGTTCT
GCCTCTTCTTGGGTTGCATGAAGCAGCGAGCTTTTACCAGCGTGCTTTGCTGGCCAATGCTCTGACCAGCGCTCTGAGGC
TGCATCAGAGATTACCTCACTTCCAGTTGAGCAGAGTGTTCCTGGCTCAGGCCTTGTTAGAGGACAGCTGCCACTACCTG
CTGTATTCACTCATCTTCGTCAACTCCTACCCTGTCACAATGAGTATTTTTCCAGTCTTGCTATTTTCTTTGCTCCATGC
TGCCACATACACTAAGAAGGTCCTGGACGCAAAGGGTTCAAATAGTTTACCTCTGTTGAGATCATTCTTGGATAAATTAA
GTACTAACCAACAAAATATTCTGAAATTCATCGCTTGTAATGAAANATTCTTGATGCCTGCTACAGGTNTTATGCTCTTT
AGNGGCCAAGGAAGNTTGCTNCANCCTTTTTTATATTATNGANTTCTTACTCTTCNATATTCCTCTAGAAAAAA
Sequence Type mRNA
Unitrap ID UNI23925

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 67652201..67675450 187
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037720 (Tmem33) NM_028975 transmembrane protein 33 Gene [Source:MGI (curated);Acc:Tmem33]

 
Come back to gene ENSMUSG00000037720


For any suggestions or comments, please send an email to unitrap@crg.es