Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST240261
Clone ID OST240261
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST240261
Sequence
TGAGGGACAGCTTGCACAGCGGCTGGTNTGGAGCTAGGGAGACTCGGCCGTTCCGTGATGAGACCTCTTCAGCCAATGGG
GACAGTCTGTTCTCCATGTTTTCAGGGCCTGACCTTGTTGCTGCTGTTAAACAGAGAAGGAAACACAGCAGTGGAGAGCA
GGAGACCAGCACACTGCCCTCACCACCTCTCCTGACCACAGTGGAGGACGTGAACCAGGATAACAAAACCAAAACGTGGC
CACCCAAAGCACCATGGCANCACCCTTCCCCGATGCCCAGGACGCTGCCCAGCCCAGTTGCACCNCTCTATGCAGNCGCC
AGTCCTGGCAGCTAGTGGAACGACACCATGCAGATGCTGCAGTCCCCTGTGTGGGCTGCAGCCAATGACTGCAATACCAC
TCTCCTTCACCTATGTTCAGACACCACCACAGNCCCCACCTCCACCNNCACANAAGGNAGNACCCATGGGCTTCAAGGCC
TTCCCTGGGAAGGCTGAACGNANGCCAGCCTATTTGNCCCAGTACTGACTACAGCTAGCCTGCTGCCCATCAAAGCTGTT
GGGGCAACTGTCCCCCAAGGCTAACTAGCTGATACTAGCCCCCAGAAGGACCAGTACACCCTGA
Sequence Type mRNA
Unitrap ID UNI23929

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 35023854..35025667 367
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066571 (4931406P16Rik) NM_172741 RIKEN cDNA 4931406P16 gene Gene [Source:MGI Symbol;Acc:MGI:1924311]

 
Come back to gene ENSMUSG00000066571


For any suggestions or comments, please send an email to unitrap@crg.es