Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST240105
Clone ID OST240105
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST240105
Sequence
ACCTGAGGACATTTGCTTAAGATCCTATTGCACCCACCAACTCCCCTGCCAACACTATGTCTGCAAAACTTGTAAAGGCA
AGAAAATGATGATGAAACCTTCATGTAGCTGGTGCAAAGACTATGAGCAGTTTGAGGAGAACAAGCAGTTAAGCATCCTA
GTGAATTGCTACAAGAAACTGTGTGAATATATAACCCAGACGACACTGGCACGGGATATAATAGAAGCAGTTGACTGTTC
TTCTGATAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI23934

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 101002895..101003143 239
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066415 (Msl2l1) male-specific lethal 2-like 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1925103]

 
Come back to gene ENSMUSG00000066415


For any suggestions or comments, please send an email to unitrap@crg.es