Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST239858
Clone ID OST239858
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST239858
Sequence
ACAGCGAGCAGCACTAAGGCTTTCGTGGGAGGCACAAAACAAGNATTACTGTGCCATTTCTTGAGCAATGTCCAATCAGG
AGGTTTATACAAGGAGAGAATGACTGAGCTGTACGACTACCCCAAGTACAGCTGCCACTTCAAGAAAGGAAAGCGGTACT
TTTATTTTTACAATACAGGTTTGCAGAACCAACGCGTGTTATATGTGCAAGACTCCTTAGAGGGGGAGGCCAGAGTGTTC
CTGGACCCCAACACACTGTCGGATGATGGTACAGTGGCACTCCGAGGTTATGCCTTCAGTGAAGATGGCGAATACTTTGC
CTATGGTCTGAGCGCCAGCGGCTTCCGACTGGGGTGACGATCAANTTCATGAAAGGTCGATGGNGCCAAAGAGCTNCCCG
GATGTGCTGGAGANNAGNNAAGTTCACCTGCNTGGGCCTGGNNNCNTGACGGGAAGGGGATGTTTTTTANNTTTTACCCC
CANNAGGACGGGAANANGGANGGGNCCAAAANCTCCCCCANTNTCCCCCAAAAGGTTTTGTTTCCACG
Sequence Type mRNA
Unitrap ID UNI7781

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 44810797..44814997 147
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019849 (Prep) NM_011156 prolyl endopeptidase Gene [Source:MGI Symbol;Acc:MGI:1270863]

 
Come back to gene ENSMUSG00000019849


For any suggestions or comments, please send an email to unitrap@crg.es