Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST239724
Clone ID OST239724
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST239724
Sequence
TGAGAGCCTAGCAATGCCGTTTGGGTGTGTGACTCTGGGTGACAAGAAGAACTATAACNAGCCATCGGAAGTGACTGACA
GATATGACCTGGGACAAGTCATCAAGAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI23948

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 107847608..107847712 103
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032936 (Camkv) NM_145621 CaM kinase-like vesicle-associated Gene [Source:MGI Symbol;Acc:MGI:2384296]

 
Come back to gene ENSMUSG00000032936


For any suggestions or comments, please send an email to unitrap@crg.es