Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST239507
Clone ID OST239507
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST239507
Sequence
CCCAGCACGGTGATGCTCTAGAATCTAAAAGTTGCTTGGCTAACAGGACGTCCTCTCGTCAGAACAAAAGGACCAGCCTC
TCGTCTTCTGACGGAACAGGTCCGAGAGTCACTGAGTCCCTAGGCCTTCCCAGGGTGTTGACTCCCTCTGACACGGTNGN
GNAGCTGGGTCAGAAGACCTACTCCTCTTNGTTNTNCTCCTCTNNCTCTGNTCAGCCTAATCGNTCCTCANGAAGTTTCG
CTGCCTGNAATCCCAAAGGAANAATATCCCGAGGAATTCANCCTGCTCAATTCACAGACAGAANATGGGCAGACGTCCTG
AGAGGACATTTTATCCAANGGTCANNAGCGNCATCCACACCTACCACATTGGAAAGNAGNGCTTNTTCAATGGGGTCTTC
CGNGGCAACAGGAGGTCTGTGCANANAGGACAGGGGACAACAGNCTCGGGAAGAAAAATAC
Sequence Type mRNA
Unitrap ID UNI23952

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45594108..45601526 151
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023935 (Spats1) NP_081925 spermatogenesis associated, serine-rich 1 Gene [Source:MGI Symbol;Acc:MGI:1918270]

 
Come back to gene ENSMUSG00000023935


For any suggestions or comments, please send an email to unitrap@crg.es