Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST239500
Clone ID OST239500
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST239500
Sequence
TGAGGTTCCTGAAGGCTTAAAGGAAACCTGATAGAGGAGGCTCAATGGCCCTGAGTGAAGATGAGGCTGAGGCAGAAGTG
TCTGTCAACACAAAGGTCCCATCCTGTGGCAGGTGGAACTCTGGGAAGCTGCTGCCCTCAGGGCTTGAACCAGATCAGCC
CCTACATCTGGGTGTTGAGGGGGGGCCACTGTGGAGGGCTGAAGCTGACCCTGGCTGCATCTCGGGAGTTTTCTTGTCAC
GGGTCCATACTGCCAGCAAAGAACCAGTAGCAGATAGGTCTAAGCCTCCCCTCAGAGGCCCGCTTCCTTCTGCCAGTGTG
GGCACTGGAGAGGTTTTACACTCTATGGGCAGCCAAATGGAGGAAGACAGGCTTCCTGCCTCCCAGGACCTACTTCCAGC
TCTTCAAGTCTTTGGAACTATAACTGTTTGCTCAGGACAGGAGGCTGNCAGTGAAAAACTTCCAGGCTACGCTTGGATCC
AT
Sequence Type mRNA
Unitrap ID UNI23572

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20140578..20142243 351
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044066 (Cep68) NM_172260 centrosomal protein 68 Gene [Source:MGI (curated);Acc:Cep68-001]

 
Come back to gene ENSMUSG00000044066


For any suggestions or comments, please send an email to unitrap@crg.es