Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST239467
Clone ID OST239467
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST239467
Sequence
TGAGTGCATATCCGAGAGAGACCACCAACGTCGCGAGGGCAGAATGGAACAGTACCGGAGGGCCGGCTCTGTAGAGCTTC
CAGCCTCATCACCAATGCCCCAGCTACCTCCTGACACTCTGGAAATGCGAGTCCGAGATGGGAGCAAAATCCGAAACCTG
CTAGGGCTGGCGCTGGGTCGTTTGGAAGGGGGAAGCACCAGGCACGTGGTGTTCTCAGGCTCTGGCCGGGCTGCTGGAAA
GGCTGTCAGCTGTGCAGAGATTGTCAAAAGGCGGGTTCCGGGCCTACACCAGCTCACCAAGCTCCGCTTCCTGCAAACGG
AGGACAGCTGGGTCCCAACTTCACCAGACACGGGACTAGACCCCCTCACAGTCCGACGCCACGTGCCTGCGGTGTGGGTA
CTGCTTAGTCGGGACCCCTTGGACCCCAGNGAATGGGGCTACCAACCCCCAAGGTGCACNTNCTTGGCCTGGGTTNCATA
CCTAGNCCCAGCTTGGGGCCCCANACCCCCGAAGANGGGCTTGGGAACACCCGGGNCCTTGAAAAATTTGGTTGGGCCCT
GAATTGGTTTTTTTTAAAACCTGGAA
Sequence Type mRNA
Unitrap ID UNI17981

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 41659320..41659848 484
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036114 (2810432D09Rik) NM_027278 RIKEN cDNA 2810432D09 gene Gene [Source:MGI Symbol;Acc:MGI:1917211]

 
Come back to gene ENSMUSG00000036114


For any suggestions or comments, please send an email to unitrap@crg.es