Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST239408
Clone ID OST239408
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST239408
Sequence
ATCATGGCTGCGGGAAAGTTTGCAAGNCCTTCCCAAAAACATGCCTGTGAATCACCAGTTCCCCTTGGCCTCGTCCATGG
NACCTCCTGAGCAGCAAGTCCCCTCTTGCTGAGCGTCGCACAGATGCCTATCAAGACGTGTCTATACATGGCACTCTTCC
ACGGGAAGAAAAAGGGCCCTCCTTCCATACGGTCCTGTGACAATGCTGGCCACTCCAAATCCCCACGACAGGAGCTCACC
TCTGACCCAGGACATCATCCAGGAAAACCCACTGCAAGACCGGAAAGGGGAAAACTTCATCTTCAGGGANCNATNNNTTC
NGGNNNCAACNATGGAANNCTTGATGAAGGGCTNTATGTTAAATGTATGCCAAG
Sequence Type mRNA
Unitrap ID UNI14547

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 122129371..122129740 289
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028121 (Bcar3) NM_013867 breast cancer anti-estrogen resistance 3 Gene [Source:MGI Symbol;Acc:MGI:1352501]

 
Come back to gene ENSMUSG00000028121


For any suggestions or comments, please send an email to unitrap@crg.es