Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST239320
Clone ID OST239320
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST239320
Sequence
GGCAGCCGTGGCAGCAATGGCCCTTGNAACCAGCAACAGTGGNATGCAGTCATTTCAGCACCAGCAAGNATCCAAGCCNG
GATTGACTGNGCTGCTTTGGCCCACGCTTGGCATTGCACAACNTAGAANCCTNAGGACNGCAAAGCNTCGTAAAACAACC
TNCAGGNAATGATGCCANATGGACAGGATNTGTCTGCAATGGAGTCTGGTCCAAATAATCATGGGAATTTTCAAGGGGAT
TCAAATTTTAACAGAATGTGGCAACCAGNNTGGNNANTGCTNNANACCNCNCTCACACNCCNCTTNAGGAGNACTNNTGG
ANGCANNCAGCTCNANGCCCATTNGACNTTGTCTCCTGGCTTTTTGAAGACAGCAACAGTTNGGACAGTGGGGANNTTGN
CCCTGNCATCAGGCATATATTTANCCANNGCAATCACAACTTTGGTGGACCACCTGATAACTTTGCAGTGGGGCCGGTGA
ACCAGTTTGACTATCANCATGGGGCTGCTTTTGGTCCACCACAAGGTGGATTTCATCCTCCTTATTGGCAACCAGGACCT
NCAGGACCTNCAGCACCTACACAGAACCGAANAGAGCGGCCACCATCATTCAG
Sequence Type mRNA
Unitrap ID UNI23960

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 21781521..21788082 152
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028248 (Sfrs18) splicing factor, arginine/serine-rich 18 Gene [Source:MGI (curated);Acc:Sfrs18-001]

 
Come back to gene ENSMUSG00000028248


For any suggestions or comments, please send an email to unitrap@crg.es