Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST239146
Clone ID OST239146
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST239146
Sequence
TGAGGAAGATGAGATTGAACCCTTGCTGGNGATNNGTAGCTTGACACCNACTCCGCTTTGGTGGGGAAAGCAAGCATTAA
AGGAATCTCAGNNTANTNTNTGCCNATTGCACGNATGCCTCGGTGNCCGCTGGCNAANGCTCACCTGTTNATNAACCGNT
CCAACCCGTNGGCTGACANTGNCAGATACATTCANGATTAGCCGNCTCTTATACCCGGGGAAGAACGGGGGACTTGGAGA
CTTCTTCGGAGACCCTGGCAATGCGCTCCCCGACTGTAACCCCTCTGGGAGTAAAGATGGGAAATACGAGCTGTTGACAG
CCGCAAACGAGGTGATCGCTGAGGAGATCAAGGATCTGATGACCAAGAGTGACATCAAGGGCCAGGATACGGAGACACTA
CTGGNAGGATCCCTGGCCAAAGCTCTGNGCTACATTCACAGAGNGAACAAGGCAGNTAANGATAATCAGGAGATGAAANC
AAGGATTTTGGGGATCA
Sequence Type mRNA
Unitrap ID UNI459

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 125032456..125040388 163
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029387 (Gtf2h3) NM_181410 general transcription factor IIH, polypeptide 3 Gene [Source:MGI (curated);Acc:Gtf2h3-001]

 
Come back to gene ENSMUSG00000029387


For any suggestions or comments, please send an email to unitrap@crg.es