Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST238962
Clone ID OST238962
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST238962
Sequence
ACCTGAGGTGGGGTCTTTACTNCAAGGAGCGGCACAAGCACCATCACCACCGCGGCTCCGATGGTGACCCCGGCGCCTGC
GTTCCGGGCGATCTCAAGCACAAGGACAAGCAGGAAAACGGCGAAAGGAGCGGAGGGGTGCCTCTGATCAAGGCCCCCAA
GAGAGAAACAGCAGATGAAAATGGTAAAACCCAGAGAGCTGATGATTTTGTCTTGAAGAAAATAATA
Sequence Type mRNA
Unitrap ID UNI23977

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 103718934..103732333 144
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044098 (Rsbn1) NM_172684 rosbin, round spermatid basic protein 1 Gene [Source:MGI (curated);Acc:Rsbn1-002]

 
Come back to gene ENSMUSG00000044098


For any suggestions or comments, please send an email to unitrap@crg.es