Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST238951
Clone ID OST238951
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST238951
Sequence
AAAGCCCTGTTCTTTCTGTTACATGAAGTGTTTAATTGCAACCCTGATCTTTCCGAGCTTGAAGTGGTGAAGCCTGAGGA
CAGTGGGATAGAAGCTTCCTACAGTCCCGTGTGTTTGGAACCTTCCTGTAATGACTGTGTTAGAAACCATGAGAGGTTGT
CTTTCATCGACTCACCAATTGTGGGACATGATAACAAGGAAAATCAACGCGTACAAAACACACTAGATAGTTCAAACGAA
ACAGAAGAGCTAGAGGCCAGTAGACTGTNTGAGGACAGTGGCTACTCATCTTTCACACAAAGTGACCGTGACGATGGCAT
CCTTATCCTGGAGAATTTCAGAAACAGTCCCCAGGCCCGTCTGCTGCCATCACAGAGCCCGGACCAGCATCCCAACAAAA
CCTTGCTGCCTGTCCTGCATTTTGAAAGAGTGGTTTGCTCAACACTAAAAAAGAATGGCNAGCGAAACCCTAAAGTGGAT
CGAGAAATGCTGAAGGAAGTTATTGCCAGCGGGAACTTTAGACTGCAAAATATAATTGGCAAAGAAAAANGGGCCTGGAG
CACCTAGACATTCCTGGCTGAGCTCTCNCGCAGGGGATTCTGTGCACCTG
Sequence Type mRNA
Unitrap ID UNI11452

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 4544021..4544628 580
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019773 (Fbxo5) NM_025995 F-box protein 5 Gene [Source:MGI (curated);Acc:Fbxo5-001]

 
Come back to gene ENSMUSG00000019773


For any suggestions or comments, please send an email to unitrap@crg.es