Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST238884
Clone ID OST238884
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST238884
Sequence
GAGGCCCTGGGCAGTGACGGGGTTCGAGTGACCATGGAGAGCGCCTTGACTGCCCGAGNACCGGGTAGGGGTGCAGGACT
TTGTCCTGCTGGAGAATTTCACCAGTGAGGCTGCCTTCATTGAGAACCTCCGGCGGCGGTTCCGGGAGAACCTCATTTAT
ACCTACATCGGTCCTGTCCTAGTCTCTGTCAATCCCTACCGAGACCTACAGATCTACAGCCGGCAGCATATGGAACGCTA
CCGTGGTGTNAGTTTCTATGAAGTACCACCTCATTTGTTTGCAGTGGCTGACACTGTATACCGGGCACTTCGTACTGAGC
GTCGGGACCAGGCAGTGATGATTTCTGGAGAGAGTGGGGCAGGCAAGACAGAGGCCACCAAGAGACTGCTCCAGTTCTAT
GCAGAGACCTGCCCAGCCCCTGAACGGGGTGGCGCAGTGCGAGACCNCCTGTTGCAGANCAACCCCGTGTTAAAGGCCTT
TGGGAATGCCAAGACTCTCCGCAACGATAACTNCAGCCGGGTTTGNAAAGTACATNGATGTGCAGNTTTGACTTCAAAGG
GTGCCCCCGNGGGGAGGCCACATTCTGAGTTACCT
Sequence Type mRNA
Unitrap ID UNI22071

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 75470992..75473707 194
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017774 (Myo1c) NM_001080775 myosin IC Gene [Source:MGI (curated);Acc:Myo1c-002]

 
Come back to gene ENSMUSG00000017774


For any suggestions or comments, please send an email to unitrap@crg.es