Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST238533
Clone ID OST238533
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST238533
Sequence
TGAGACCCCTGCTATTGCTGATATCTACNCAGAACNTGCCCATCNAGTGGTAGTAGCCTAGTATGCACCCAGCGGATTCT
ACATTGCTTCTGGAGACATCTCTGGGAAGCTAAGGATCTGGGATACCACACAGAAGGAGCATCTTCTAAAGTATGAGTAC
CAGCCTTTCGCTGGGAAGATCAAGGACATTGCCTGGACGGAAGACAGTAAGAGGATCGCCGTGGTCGGGGAAGGAAGGGA
GAAGTTTGGAGCTGTCTTCTTATGGGACACTGGCTCTTCTGTGGGTGAGATCACAGGACACAACAAAGTCATCAACAGTG
TGGACATAAAGCAGACCAGGCCCTACCGACTAGCAACAGGGAGTGATGATAACTGTGCTGCGTTCTTCGAGGGCCCTCCA
TTCAAGTTCAAGTTCACAATTGGTGACCACAGCCGCTTTGTCAACTGTGTGCGATTCTCTCCTGATGGGAACAGATTTGC
CACAGCTAGCGCTGATGGCCAGATTTTCATTTATGATGGGAAGACGGGAGAGAAGGTGTGTGCCCTTGGAGAAAGCAAGG
CCCATGATGGAGGAATTTATGCCATTAGTTGGAGTCCTGATAGCACTCATTTGCTATCTGC
Sequence Type mRNA
Unitrap ID UNI23984

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 38931448..38942708 184
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005103 (Wdr1) NP_035845 WD repeat domain 1 Gene [Source:MGI Symbol;Acc:MGI:1337100]

 
Come back to gene ENSMUSG00000005103


For any suggestions or comments, please send an email to unitrap@crg.es